LC-MS/MS raises a handful of sensible questions. This page answers them in order, starting with the fundamentals and moving to applications.
This page was last updated on 2026-05-02 and is reviewed periodically as new material appears.
Synthesis occurs in two ATP-dependent steps. The enzyme glutamate-cysteine ligase joins glutamate and cysteine to form gamma-glutamylcysteine, and glutathione synthetase adds glycine. The first step is rate-limiting and is influenced by cysteine availability and feedback inhibition by GSH. Breakdown involves gamma-glutamyl transferase and subsequent peptidases, which release constituent amino acids for reuse. Because turnover differs among tissues, measurements from blood, plasma, and tissues are not directly interchangeable. Research continues to clarify how compartment-specific pools are regulated in health and disease.
Glutathione is a tripeptide composed of glutamate, cysteine, and glycine. It contains an unusual gamma-glutamyl bond between glutamate and cysteine, which resists cleavage by many peptidases. The reduced form, GSH, carries a thiol group on cysteine and is the dominant intracellular form in most cells. Its structure allows it to participate in redox reactions and to serve as a sulfur donor. The oxidized form, GSSG, consists of two GSH molecules joined by a disulfide bond.
In cells, glutathione helps maintain the reducing environment of the cytosol and supports enzymes that counteract reactive oxygen species. It acts as a cofactor for glutathione peroxidases, which reduce hydrogen peroxide and lipid peroxides, and for glutathione S-transferases, which conjugate electrophiles. The ratio of GSH to GSSG is often used as an indicator of oxidative stress, although the ratio can vary by compartment and cell type. Glutathione also stores cysteine, an amino acid that can be limiting for protein synthesis and antioxidant defense.
Storage conditions strongly influence glutathione stability. The solid reduced form is commonly kept desiccated at or below minus twenty degrees Celsius, protected from light and moisture. Aqueous solutions are less stable because the thiol group reacts with dissolved oxygen, and oxidation accelerates at neutral or alkaline pH. Acidic solutions and oxygen-free handling can slow degradation, but repeated freeze-thaw cycles should be avoided. Researchers often verify concentration before use, because apparent losses can arise from oxidation or water uptake.
Measuring glutathione in biological samples requires attention to oxidation and matrix effects. High-performance liquid chromatography with ultraviolet or fluorescence detection can separate reduced and oxidized forms after derivatization. Liquid chromatography with tandem mass spectrometry offers higher specificity and can quantify glutathione alongside related thiols. Because glutathione can oxidize during sample handling, many protocols use rapid acidification with metaphosphoric acid or sulfosalicylic acid. Internal standards help correct for losses during extraction and analysis.
Enzymatic recycling assays provide a complementary approach for total glutathione. In these methods, glutathione reductase reduces oxidized glutathione while a thiol-reactive reagent, such as 5,5'-dithiobis(2-nitrobenzoic acid), produces a colored product. The reaction cycles between reduced and oxidized forms, amplifying the signal. Spectrophotometric or fluorometric detection can then estimate concentration. Distinguishing reduced glutathione from glutathione disulfide often requires separate aliquots, masking agents, or chromatographic separation, and the choice affects reported values.
| Property | Value | Notes |
|---|---|---|
| Chemical formula | C10H17N3O6S | For reduced glutathione; the oxidized dimer has two sulfur atoms. |
| Molar mass | 307.32 g/mol | Calculated for the reduced form. |
| Appearance | White to off-white crystalline powder | Typical for solid reagent; solutions are usually colorless. |
| Solubility | Freely soluble in water | Poorly soluble in nonpolar organic solvents. |
| Typical storage | -20 °C, desiccated, protected from light | Limits oxidation, moisture uptake, and degradation. |
Cells synthesize glutathione through two ATP-dependent steps: glutamate-cysteine ligase joins glutamate and cysteine, and glutathione synthetase adds glycine to form the complete tripeptide. Breakdown occurs through gamma-glutamyl transpeptidase and subsequent peptidase reactions, forming the gamma-glutamyl cycle. Within cells, glutathione also forms a disulfide-linked dimer called GSSG when two GSH molecules react. The balance between GSH and GSSG is widely used as an indicator of oxidative conditions, although the ratio can vary by compartment and tissue.
Glutathione supports several cellular processes beyond direct antioxidant action. It serves as a cofactor for glutathione peroxidase and glutathione S-transferase enzymes, which reduce peroxides and conjugate electrophiles, respectively. The molecule also acts as a reservoir of cysteine, an amino acid that can limit protein synthesis and redox signaling. In human nutrition, oral glutathione is sold as a supplement, but how much intact glutathione reaches tissues after ingestion remains an active research question. Clinical claims about supplementation are not uniformly supported by controlled trials.
Glutathione is a small tripeptide built from glutamic acid, cysteine, and glycine. Its peptide bond between glutamate and cysteine involves the gamma-carboxyl group rather than the usual alpha-carboxyl group. This structure gives the molecule a reactive thiol on the cysteine residue. The reduced form, often abbreviated GSH, is the predominant intracellular species in many cell types. Because the thiol can donate electrons, glutathione participates in redox chemistry and in the conjugation of reactive molecules.
For solid glutathione reagents, storage at low temperature and protection from moisture and light are typical precautions. Aqueous solutions can oxidize over time, and pH affects stability; alkaline conditions generally promote thiol oxidation. Some protocols prepare fresh solutions, while others use antioxidants or chelators to limit metal-catalyzed oxidation. Purity and counterion content can vary among commercial preparations, affecting concentration calculations. Certificates of analysis and validated assays help verify identity and purity.
Measuring glutathione in biological samples requires attention to oxidation, because GSH can convert to GSSG after sample collection. Blood and plasma samples are often treated with acid or alkylating agents to preserve the reduced form. Without stabilization, apparent GSH concentrations can fall while GSSG rises. Differences in sample type, handling delay, and deproteinization method can produce results that are not comparable across studies. Reporting preanalytical details is therefore important for interpreting findings.
Glutathione is present in most tissues, with especially high concentrations in the liver. It also serves as a cofactor for some enzymes and helps transport amino acids across cell membranes. In plants and microorganisms, glutathione contributes to stress responses and metal handling. The molecule is synthesized in two ATP-dependent steps, first producing gamma-glutamylcysteine and then adding glycine. Because cysteine availability often limits synthesis, dietary and metabolic factors can influence glutathione levels. Research continues to examine how these levels relate to health and disease.
Glutathione is a tripeptide composed of glutamate, cysteine, and glycine. The peptide bond between glutamate and cysteine uses the gamma-carboxyl group of glutamate rather than the alpha-carboxyl group. This unusual linkage protects the molecule from many common peptidases. The cysteine side chain carries a thiol group that can undergo reversible oxidation. Because of this thiol, glutathione participates in redox reactions and helps maintain the reducing environment inside most cells in living systems.
Glutathione serves as a cofactor for several enzymes, including glutathione peroxidase and glutathione S-transferase. These enzymes help reduce hydrogen peroxide and lipid peroxides, and they conjugate reactive electrophiles for excretion. The molecule also acts as a reservoir for cysteine, an amino acid that is prone to oxidation. In addition, glutathione participates in the metabolism of nitric oxide, leukotrienes, and prostaglandins. Its roles extend to cell signaling, apoptosis, and the regulation of protein function through S-glutathionylation.
Glutathione is a tripeptide composed of glutamate, cysteine, and glycine, and it is the most abundant non-protein thiol in most living cells. The reduced form, GSH, carries a sulfhydryl group that can donate electrons, while the oxidized form, GSSG, forms when two GSH molecules link via a disulfide bond. The balance between these two forms helps define the cellular redox environment, and their ratio is often used as an indicator of oxidative stress. Because the sulfhydryl group is reactive, glutathione participates in many cellular processes, including detoxification and protein regulation.
Glutathione is synthesized in two ATP-dependent steps. First, gamma-glutamylcysteine synthetase links glutamate and cysteine; second, glutathione synthetase adds glycine to form the complete tripeptide. The pathway is feedback-inhibited by GSH itself, which helps maintain steady intracellular levels. Tissues vary widely in glutathione content, with the liver typically containing the highest concentrations, followed by the kidneys, lungs, and erythrocytes. Because cysteine is often limiting, its availability influences synthesis rates, and regulation of this pathway varies by cell type.
=== Glycolysis === Glycolysis is the process of breaking down a glucose molecule into two pyruvate molecules, while storing energy released during this process as adenosine triphosphate (ATP) and nicotinamide adenine dinucleotide (NADH). Nearly all organisms that break down glucose utilize glycolysis. Glucose regulation and product use are the primary categories in which these pathways differ between organisms. In some tissues and organisms, glycolysis is the sole method of energy production. This pathway is common to both anaerobic and aerobic respiration. Glycolysis consists of ten steps, split into two phases. During the first phase, it requires the breakdown of two ATP molecules. During the second phase, chemical energy from the intermediates is transferred into ATP and NADH. The breakdown of one molecule of glucose results in two molecules of pyruvate, which can be further oxidized to access more energy in later processes. Glycolysis can be regulated at different steps of the process through feedback regulation. The step that is regulated the most is the third step. This regulation is to ensure that the body is not over-producing pyruvate molecules. The regulation also allows for the storage of glucose molecules into fatty acids. There are various enzymes that are used throughout glycolysis. The enzymes upregulate, downregulate, and feedback regulate the process.
== Effects == Experts initially did not expect SVB's collapse to pose a systemic risk to the U.S. financial system. However, although experts think these effects are temporary, the bank's collapse created hardships among some tech startups, and companies holding significant uninsured deposits and low cash flow faced significant risks.
The upper esophagus lies at the back of the mediastinum behind the trachea, adjoining along the tracheoesophageal stripe, and in front of the erector spinae muscles and the vertebral column. The lower esophagus lies behind the heart and curves in front of the thoracic aorta. From the bifurcation of the trachea downwards, the esophagus passes behind the right pulmonary artery, left main bronchus, and left atrium. At this point, it passes through the diaphragm. The thoracic duct, which drains the majority of the body's lymph, passes behind the esophagus, curving from lying behind the esophagus on the right in the lower part of the esophagus, to lying behind the esophagus on the left in the upper esophagus. The esophagus also lies in front of parts of the hemiazygos veins and the intercostal veins on the right side. The vagus nerve divides and covers the esophagus in a plexus.
Using ConA-couple matrices, such enzymes may be immobilized in high quantities without a concurrent loss of activity or stability. Such noncovalent ConA-glycoenzyme couplings may be relatively easily reversed by competition with sugars or at acidic pH. If necessary for certain applications, these couplings can be converted to covalent bindings by chemical manipulation. A report from Taiwan (2009) demonstrated potent therapeutic effect of ConA against experimental hepatoma (liver cancer); in the study by Lei and Chang, ConA was found to be sequestered more by hepatic tumor cells, in preference to surrounding normal hepatocytes. Internalization of ConA occurs preferentially to the mitochondria after binding to cell membrane glycoproteins, which triggers an autophagic cell death. ConA was found to partially inhibit tumor nodule growth independent of its lymphocyte activation; the eradication of the tumor in the murine in-situ hepatoma model in this study was additionally attributed to the mitogenic/lymphoproliferative action of ConA that may have activated a CD8+ T-cell-mediated, as well as NK- and NK-T cell-mediated, immune response in the liver. ConA intravitreal injection can be used in the modeling of proliferative vitreoretinopathy in rats.
In construction engineering, in situ construction refers to building work carried out directly on-site using raw materials, as opposed to prefabrication, where components are manufactured off-site and assembled on-site. In situ concrete is poured at its final location, offering structural stability compared to precast construction. In wall construction, reinforcing bars are assembled first, followed by the installation of formwork to contain the poured concrete. Once the concrete has cured, the formwork is removed, leaving the wall in place. Prefabrication, in contrast, reduces on-site labor requirements and shortens project timelines, but requires precise pre-planning and involves higher manufacturing and transportation costs. In geotechnical engineering, the term in situ describes soil in its natural, undisturbed state, as opposed to fill material, which has been excavated and relocated. The differences between undisturbed soil and fill material affect how well a site can support structures, install underground utilities, and manage water drainage. Proper assessment of soil conditions is necessary to prevent issues such as uneven settling, unstable foundations, and poor water infiltration.
Sources: en.wikipedia.org
==== Different Conservative Party leaders: voting intention and seat projections ==== For the 2024 Conservative Party leadership election, Electoral Calculus conducted a multilevel regression with poststratification (MRP) opinion poll on behalf of Jack Lewy of the Robert Jenrick campaign, asking the general public how they would vote if respectively Kemi Badenoch or Robert Jenrick were elected leader of the Conservatives.
The Stanley Infant & Junior School (IJS) is located along John Street at the intersection with Villiers Street in Stanley. The school first opened in 1955 and has about 250 students between the ages of four and 11. The Falkland Islands Community School (FICS) is located on Reservoir Road in Stanley. It has approximately 220 students between 11 and 16.
=== Coarse-grained molecular models === Molecular dynamics and Monte Carlo simulations have been extensively used to gain insights into the formation and the material properties of biomolecular condensates. Although molecular models of different resolution have been employed, modelling efforts have mainly focused on coarse-grained models of intrinsically disordered proteins, wherein amino acid residues are represented by single interaction sites. Compared to more detailed molecular descriptions, residue-level models provide high computational efficiency, which enables simulations to cover the long length and time scales required to study phase separation. Moreover, the resolution of these models is sufficiently detailed to capture the dependence on amino acid sequence of the properties of the system. Several residue-level models of intrinsically disordered proteins have been developed in recent years. Their common features are (i) the absence of an explicit representation of solvent molecules and salt ions, (ii) a mean-field description of the electrostatic interactions between charged residues (see Debye–Hückel theory), and (iii) a set of "stickiness" parameters which quantify the strength of the attraction between pairs of amino acids. In the development of most residue-level models, the stickiness parameters have been derived from hydrophobicity scales or from a bioinformatic analysis of crystal structures of folded proteins.
Narrated by Alun Lewis, directed by Gary Leach, produced by Geoff Deehan, produced by Sandlin Productions 24 November The Dyslexic Engineer, about Ben Bowlby, born on 2 November 1966; his VS91 car at Snetterton Circuit, with a Vauxhall Astra engine, with footage mostly from the end of the earlier documentary in September 1990; his studies at the Polytechnic of East London; Richard Bowlby, his father from Hampstead, who also realised that he was dyslexic; Rosalind Rathouse, his former remedial teacher; Roy Greenfield, a retired maths teacher from King Alfred School, London, who believed that perhaps people would adapt to mathematics more if the subject was taught later in life, as people are often put off the subject at secondary school; Ben gained nine O-levels but couldn't acquire Mathematics A-level above grade E after, two attempts; Xenia Bowlby; his polytechnic course tutor, Alan Slawson, and limited-slip differentials; his car raced in the Clubman (racing car class); he was sponsored by Ripspeed clothing and Spax Performance shock absorbers; Eric Broadly of Lola Cars; he joined Lola Cars in October 1991; he had attempted to gain a place at Lancaster University to study Engineering; Mike Blanchet of Lola Cars; empirical research in designing and building motor racing cars; Mark Williams, head of Formula 3000 at Lola Cars. Narrated by Ian Holm, produced by Michael Proudfoot, directed by Patrick Uden, made by Uden Associates.
Sources: en.wikipedia.org
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
== Pharmacology == Setmelanotide binds to and activates MC4 receptors in the paraventricular nucleus (PVN) of the hypothalamus and in the lateral hypothalamic area (LHA), areas involved in the regulation of appetite, and this action is thought to underlie its appetite suppressant effects. In addition to reducing appetite, setmelanotide increases resting energy expenditure in both obese animals and humans. Importantly, unlike certain other MC4 receptor agonists, such as LY-2112688, setmelanotide has not been found to produce increases in heart rate or blood pressure. Setmelanotide has been reported to possess the following activity profile (cAMP, EC50): MC4 (0.27 nM) > MC3 (5.3 nM) ≈ MC1 (5.8 nM) > MC5 (1600 nM) ≟ MC2 (>1000 nM). (19.6-fold selectivity for MC4 over MC3, the second target of highest activity.)
=== Brush type columns (Pirkle Type) === The brush type, or Pirkle type chiral stationary phases are also called π-π Donnor-Acceptor columns. According to some theoretical models separation on these CSPs are based on a three-point attachment between the solute and the bonded chiral ligand on the surface of the stationary phase. These interactions may be attractive or repulsive in nature, depending on the mutual properties. Pirkle columns discriminate enantiomers by binding of one enantiomer with the chiral stationary phase, thereby forming a diastereomeric complex through π-π bonding, hydrogen bonding, steric interactions, and/or dipole stacking. Pirkle CSP can be categorized into three classes: (i) π-electron acceptor (ii) π-electron donor (iii) π-electron donor-π-electron acceptor.
=== Optimal solution === The optimal "threading" of a protein sequence onto a known structure and the production of an optimal multiple sequence alignment have been shown to be NP-complete. However, this does not imply that the structural alignment problem is NP-complete. Strictly speaking, an optimal solution to the protein structure alignment problem is only known for certain protein structure similarity measures, such as the measures used in protein structure prediction experiments, GDT_TS and MaxSub. These measures can be rigorously optimized using an algorithm capable of maximizing the number of atoms in two proteins that can be superimposed under a predefined distance cutoff. Unfortunately, the algorithm for optimal solution is not practical, since its running time depends not only on the lengths but also on the intrinsic geometry of input proteins.
A descendant of citrus cultivars that cannot produce the problematic polyphenol compounds would presumably also lack the genes to produce them. Many citrus cultivars are hybrids of a small number of ancestral species, which have now been fully genetically sequenced. Many traditional citrus groups, such as true sweet oranges and lemons, seem to be bud sports, mutant descendants of a single hybrid ancestor. In theory, cultivars in a bud sport group would be either all safe or all problematic. Nonetheless, new citrus varieties arriving on the market are increasingly likely to be sexually created hybrids, not asexually created sports. The ancestry of a hybrid cultivar may not be known. Even if it is known, it is not possible to be certain that a cultivar will not interact with drugs on the basis of taxonomy, as it is not known which ancestors lack the capacity to make the problematic polyphenol compounds. Nonetheless, many of the citrus cultivars known to be problematic seem to be closely related.
Sources: en.wikipedia.org
GSH is the reduced form with a free thiol group, while GSSG is the oxidized disulfide-linked dimer. Most assays distinguish the two because their balance reflects redox conditions. The names are not interchangeable.
It is synthesized in the body from amino acids, so it is not classified as an essential dietary nutrient for most people. Dietary and supplemental forms are studied for their effects on tissue levels and health markers. Evidence varies by population and outcome.
The phrase highlights its high intracellular concentration and its role in several antioxidant and detoxification reactions. It is not the only antioxidant, and the term can oversimplify its functions. Scientific descriptions usually specify the pathway or enzyme involved.
Chromatographic methods can separate the two forms before detection. Enzymatic assays often measure total glutathione first and then use a separate procedure to estimate the oxidized fraction. The difference between total and oxidized amounts provides an indirect estimate of the reduced form.